Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 3749983
End position: 3750024
Length: 42

DNA sequence
>NC_002927, from 3749983 to 3750024 (42 bp); Bordetella bronchiseptica CGTCACGCGTTACGTTACGCGTGACGTTACGCGTGACGTCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3749646-3750470	Sequence	BB3512 - hypothetical protein (Protein is coded in complementary strand; from 3750470 to 3749646)