Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 3523013
End position: 3523053
Length: 41

DNA sequence
>NC_002927, from 3523013 to 3523053 (41 bp); Bordetella bronchiseptica GGCGGCGCTTCGGGCGGGGCTTCGGGCGGCGCTTCGGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3521978-3523819	Sequence	BB3292 bapB autotransporter (Protein is coded in complementary strand; from 3523819 to 3521978)