Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 3185053
End position: 3185090
Length: 38

DNA sequence
>NC_002927, from 3185053 to 3185090 (38 bp); Bordetella bronchiseptica GGTGCGGGCGCGGGCGCGGGCGCGGGCGCGGGCGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3184702-3195660	Sequence	BB2993 fhaB filamentous hemagglutinin/adhesin (Protein is coded in complementary strand; from 3195660 to 3184702)