Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 3846203
End position: 3846239
Length: 37

DNA sequence
>NC_002927, from 3846203 to 3846239 (37 bp); Bordetella bronchiseptica GTGGCGGTGCCGGTGACGGTGGCCGTGCCGGTGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3845132-3846559	Sequence	BB3621 - phage tail sheath protein (Protein is coded in complementary strand; from 3846559 to 3845132)