Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 2876581
End position: 2876617
Length: 37

DNA sequence
>NC_002927, from 2876581 to 2876617 (37 bp); Bordetella bronchiseptica CGGCCAGCCCCACGGCCAGCATCACCGCCAGCCCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2875953-2876918	Sequence	BB2713 - sugar ABC transport system, permease (Protein is coded in complementary strand; from 2876918 to 2875953)