Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 281270
End position: 281306
Length: 37

DNA sequence
>NC_002927, from 281270 to 281306 (37 bp); Bordetella bronchiseptica ACGGCCGCGCGCACGCCCGGGCGCAGCGCCGCGCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 280460-281722	Sequence	BB0278 - ferredoxin reductase (Protein is coded in complementary strand; from 281722 to 280460)