Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 1658180
End position: 1658216
Length: 37

DNA sequence
>NC_002927, from 1658180 to 1658216 (37 bp); Bordetella bronchiseptica GTTGCGGCCAGCGTGGCCGCCAGCGTGGCGGCCAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1657100-1658239	Sequence	BB1551 - amino acid ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 1658239 to 1657100)