Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 784946
End position: 784981
Length: 36

DNA sequence
>NC_002927, from 784946 to 784981 (36 bp); Bordetella bronchiseptica CCGCGCCGATGGCCGCGCCGTTGACGGCGGCGATGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 784486-785295	Sequence	BB0750 - enoyl-CoA hydratase (Protein is coded in complementary strand; from 785295 to 784486)