Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 4878473
End position: 4878508
Length: 36

DNA sequence
>NC_002927, from 4878473 to 4878508 (36 bp); Bordetella bronchiseptica CCGTGCCCGCCGCCATGGCCGCCGCCGTGCGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4878092-4878586	Sequence	BB4581 - blue copper protein (Protein is coded in complementary strand; from 4878586 to 4878092)