Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 4369071
End position: 4369106
Length: 36

DNA sequence
>NC_002927, from 4369071 to 4369106 (36 bp); Bordetella bronchiseptica GCGCCGATGCCGGCGCCGATCGCGGCGCCCTTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4368612-4369259	Sequence	BB4107 - outer membrane protein (Protein is coded in complementary strand; from 4369259 to 4368612)