Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 2746647
End position: 2746679
Length: 33

DNA sequence
>NC_002927, from 2746647 to 2746679 (33 bp); Bordetella bronchiseptica GGCGGCGTCGGCGGCGTCGGCGGCGTCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2745640-2746983	Sequence	BB2583 fliK flagellar hook-length control protein (Protein is coded in complementary strand; from 2746983 to 2745640)