Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 1090793
End position: 1090825
Length: 33

DNA sequence
>NC_002927, from 1090793 to 1090825 (33 bp); Bordetella bronchiseptica CGGGGAAGGGGCGGGGAAGGAATGGGGCAGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1090776-1092083	Sequence	BB1009 - hypothetical protein (Protein is coded in complementary strand; from 1092083 to 1090776)