Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 359210
End position: 359241
Length: 32

DNA sequence
>NC_002927, from 359210 to 359241 (32 bp); Bordetella bronchiseptica CGGCGCCGTCGCCGGCGCCGGCGACGGCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 358447-359310	Sequence	BB0346 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 359310 to 358447)