Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 823629
End position: 823658
Length: 30

DNA sequence
>NC_002927, from 823629 to 823658 (30 bp); Bordetella bronchiseptica TGCTGCTGCCGCCGCTGCTGCCGCTGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 822584-824221	Sequence	BB0784 - type II secretion system protein (Protein is coded in complementary strand; from 824221 to 822584)