Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 708448
End position: 708477
Length: 30

DNA sequence
>NC_002927, from 708448 to 708477 (30 bp); Bordetella bronchiseptica GGGCGCGCGAGGGCGCGCCGGAGCCCGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 707730-708764	Sequence	BB0672 - hypothetical protein (Protein is coded in complementary strand; from 708764 to 707730)