Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 69521
End position: 69550
Length: 30

DNA sequence
>NC_002927, from 69521 to 69550 (30 bp); Bordetella bronchiseptica GCCGCGAGCGACCGCGCGCGGGCGCGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 69158-69817	Sequence	BB0074 - glutathione S-transferase (Protein is coded in complementary strand; from 69817 to 69158)