Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 534634
End position: 534663
Length: 30

DNA sequence
>NC_002927, from 534634 to 534663 (30 bp); Bordetella bronchiseptica CGGGGCGGGGCGGGGCGGCTCGGCGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 534503-534754	Sequence	BB0504 - hypothetical protein (Protein is coded in complementary strand; from 534754 to 534503)