Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 5004354
End position: 5004383
Length: 30

DNA sequence
>NC_002927, from 5004354 to 5004383 (30 bp); Bordetella bronchiseptica GCGGCGGCTGCGGCGCCGGCGCCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5003405-5004655	Sequence	BB4703 - 2-oxo acid dehydrogenase acyltransferase (Protein is coded in complementary strand; from 5004655 to 5003405)