Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 4882036
End position: 4882065
Length: 30

DNA sequence
>NC_002927, from 4882036 to 4882065 (30 bp); Bordetella bronchiseptica GCGGCGGGGCGCGGCGGTACTCGACGGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4881948-4883177	Sequence	BB4584 - hypothetical protein (Protein is coded in complementary strand; from 4883177 to 4881948)