Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 3108418
End position: 3108447
Length: 30

DNA sequence
>NC_002927, from 3108418 to 3108447 (30 bp); Bordetella bronchiseptica GGCGCGCCACAGCGCGCCGCGGCGCGTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3106955-3109039	Sequence	BB2928 wbpT capsular polysaccharide biosynthesis protein (Protein is coded in complementary strand; from 3109039 to 3106955)