Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 2078355
End position: 2078384
Length: 30

DNA sequence
>NC_002927, from 2078355 to 2078384 (30 bp); Bordetella bronchiseptica CGCCCAGGCGCGCCCGCGCGCGCTCGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2077577-2078488	Sequence	BB1941 - hypothetical protein (Protein is coded in complementary strand; from 2078488 to 2077577)