Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 1319314
End position: 1319343
Length: 30

DNA sequence
>NC_002927, from 1319314 to 1319343 (30 bp); Bordetella bronchiseptica GCGGCAGCGCGTGGCCGCGCGCGGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1318920-1320365	Sequence	BB1225 - amidase (Protein is coded in complementary strand; from 1320365 to 1318920)