Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 1039395
End position: 1039422
Length: 28

DNA sequence
>NC_002927, from 1039395 to 1039422 (28 bp); Bordetella bronchiseptica GTCCATGCCGCCCATGCCGCCCATGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1039390-1041033	Sequence	BB0962 groEL chaperonin GroEL (Protein is coded in complementary strand; from 1041033 to 1039390)