Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 3543539
End position: 3543565
Length: 27

DNA sequence
>NC_002927, from 3543539 to 3543565 (27 bp); Bordetella bronchiseptica GCCCAGGGCGCCCAGCGCGCCCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3542847-3544133	Sequence	BB3315 - transporter (Protein is coded in complementary strand; from 3544133 to 3542847)