Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 3480892
End position: 3480918
Length: 27

DNA sequence
>NC_002927, from 3480892 to 3480918 (27 bp); Bordetella bronchiseptica CCTCGACCGCATCGACCGCCTCGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3480396-3481490	Sequence	BB3250 - hypothetical protein (Protein is coded in complementary strand; from 3481490 to 3480396)