Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 3252382
End position: 3252408
Length: 27

DNA sequence
>NC_002927, from 3252382 to 3252408 (27 bp); Bordetella bronchiseptica GCGGCCTGCTCGGCCTGCTCGGCCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3251380-3254025	Sequence	BB3047 - GTP-binding protein (Protein is coded in complementary strand; from 3254025 to 3251380)