Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 1596405
End position: 1596431
Length: 27

DNA sequence
>NC_002927, from 1596405 to 1596431 (27 bp); Bordetella bronchiseptica GCCAGCGCCGCCACCGCCGCCAGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1595508-1596455	Sequence	BB1491 - high-affinity branched-chain amino acid transporter membrane protein (Protein is coded in complementary strand; from 1596455 to 1595508)