Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 5221574
End position: 5221599
Length: 26

DNA sequence
>NC_002927, from 5221574 to 5221599 (26 bp); Bordetella bronchiseptica CCGCCGCTGCCGCCGCCTCCGCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5221454-5222368	Sequence	BB4912 - hypothetical protein (Protein is coded in complementary strand; from 5222368 to 5221454)