Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 5084669
End position: 5084694
Length: 26

DNA sequence
>NC_002927, from 5084669 to 5084694 (26 bp); Bordetella bronchiseptica CCAGCCGGCCAGCCGGCCAGCCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5084645-5084836	Sequence	BB4779 - hypothetical protein (Protein is coded in complementary strand; from 5084836 to 5084645)