Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 433295
End position: 433320
Length: 26

DNA sequence
>NC_002927, from 433295 to 433320 (26 bp); Bordetella bronchiseptica CGGCGCGCCGCTGCGCGGCGCGGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 433213-436161	Sequence	BB0420 ppc phosphoenolpyruvate carboxylase (Protein is coded in complementary strand; from 436161 to 433213)