Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 3345224
End position: 3345249
Length: 26

DNA sequence
>NC_002927, from 3345224 to 3345249 (26 bp); Bordetella bronchiseptica CGCCGGCGACGGCGCCAGCGCCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3344127-3345809	Sequence	BB3134 ilvB hypothetical protein (Protein is coded in complementary strand; from 3345809 to 3344127)