Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 3076179
End position: 3076204
Length: 26

DNA sequence
>NC_002927, from 3076179 to 3076204 (26 bp); Bordetella bronchiseptica TCGCCAGCGCCAACGCCAGCGCCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3075749-3076987	Sequence	BB2907 livM leucine/isoleucine/valine transporter permease subunit (Protein is coded in complementary strand; from 3076987 to 3075749)