Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 820830
End position: 820854
Length: 25

DNA sequence
>NC_002927, from 820830 to 820854 (25 bp); Bordetella bronchiseptica GCGCGCGGCGCGTGGCGCGCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 820271-821650	Sequence	BB0782 - type II secretion system protein (Protein is coded in complementary strand; from 821650 to 820271)