Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 5084667
End position: 5084691
Length: 25

DNA sequence
>NC_002927, from 5084667 to 5084691 (25 bp); Bordetella bronchiseptica GCCCAGCCGGCCAGCCGGCCAGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5084645-5084836	Sequence	BB4779 - hypothetical protein (Protein is coded in complementary strand; from 5084836 to 5084645)