Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 4256362
End position: 4256386
Length: 25

DNA sequence
>NC_002927, from 4256362 to 4256386 (25 bp); Bordetella bronchiseptica CGCGCGCGGGCGCCCGCGCGCGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4256119-4257939	Sequence	BB4007 - ATP-dependent DNA helicase (Protein is coded in complementary strand; from 4257939 to 4256119)