Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 3950288
End position: 3950312
Length: 25

DNA sequence
>NC_002927, from 3950288 to 3950312 (25 bp); Bordetella bronchiseptica CGCCAGCGACAGCCCCAGCGCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3949512-3950852	Sequence	BB3726 - integral membrane protein (Protein is coded in complementary strand; from 3950852 to 3949512)