Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 3465833
End position: 3465857
Length: 25

DNA sequence
>NC_002927, from 3465833 to 3465857 (25 bp); Bordetella bronchiseptica CGCGGCGCGGCGCTGCTCGGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3465318-3468032	Sequence	BB3239 polA DNA polymerase I (Protein is coded in complementary strand; from 3468032 to 3465318)