Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 2928594
End position: 2928618
Length: 25

DNA sequence
>NC_002927, from 2928594 to 2928618 (25 bp); Bordetella bronchiseptica GCGCCTGGCGCCGGGCACCTGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2928514-2929656	Sequence	BB2763 - thiolase (Protein is coded in complementary strand; from 2929656 to 2928514)