Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 2723743
End position: 2723767
Length: 25

DNA sequence
>NC_002927, from 2723743 to 2723767 (25 bp); Bordetella bronchiseptica GGCCTGCGCCTGGACCTGGGCCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2723123-2723827	Sequence	BB2561 flgD flagellar basal body rod modification protein