Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 2294916
End position: 2294940
Length: 25

DNA sequence
>NC_002927, from 2294916 to 2294940 (25 bp); Bordetella bronchiseptica CGTCGTCGTCCTCGTCCTCGTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2294903-2295175	Sequence	BB2146 - hypothetical protein (Protein is coded in complementary strand; from 2295175 to 2294903)