Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 1693418
End position: 1693442
Length: 25

DNA sequence
>NC_002927, from 1693418 to 1693442 (25 bp); Bordetella bronchiseptica GCCAGCGCCGGCGCCAGGCCCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1693118-1694017	Sequence	BB1585 - hypothetical protein (Protein is coded in complementary strand; from 1694017 to 1693118)