Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 1398905
End position: 1398929
Length: 25

DNA sequence
>NC_002927, from 1398905 to 1398929 (25 bp); Bordetella bronchiseptica GGCGCGGCCCGGCTCGACGCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1398813-1399778	Sequence	BB1310 - ubiquinol oxidase subunit II (Protein is coded in complementary strand; from 1399778 to 1398813)