Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 1293321
End position: 1293345
Length: 25

DNA sequence
>NC_002927, from 1293321 to 1293345 (25 bp); Bordetella bronchiseptica CCGCGCCCGCGTCCGAGCCCGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1292573-1293739	Sequence	BB1199 - acyl-CoA dehydrogenase (Protein is coded in complementary strand; from 1293739 to 1292573)