Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 1077566
End position: 1077590
Length: 25

DNA sequence
>NC_002927, from 1077566 to 1077590 (25 bp); Bordetella bronchiseptica CATCAGCGTCAGCATCTGCAGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1077147-1077920	Sequence	BB0997 - spermidine/putrescine ABC transporter permease (Protein is coded in complementary strand; from 1077920 to 1077147)