Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 5321574
End position: 5321597
Length: 24

DNA sequence
>NC_002927, from 5321574 to 5321597 (24 bp); Bordetella bronchiseptica GGCGGCGGCGCCAGCGGCGACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5321439-5322455	Sequence	BB5000 - transport ATP-binding protein (Protein is coded in complementary strand; from 5322455 to 5321439)