Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 4988215
End position: 4988238
Length: 24

DNA sequence
>NC_002927, from 4988215 to 4988238 (24 bp); Bordetella bronchiseptica GCCAGCCCCAGCTCCAGCGCCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4987642-4988448	Sequence	BB4690 - transcriptional regulator (Protein is coded in complementary strand; from 4988448 to 4987642)