Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 4794314
End position: 4794337
Length: 24

DNA sequence
>NC_002927, from 4794314 to 4794337 (24 bp); Bordetella bronchiseptica CAGCGCCAGGGCCAGCGCCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4792686-4794386	Sequence	BB4494 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 4794386 to 4792686)