Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 4761250
End position: 4761273
Length: 24

DNA sequence
>NC_002927, from 4761250 to 4761273 (24 bp); Bordetella bronchiseptica GGCCACGGCCACCGCCACGGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4761230-4762792	Sequence	BB4465 ubiB ubiquinone biosynthesis protein UbiB (Protein is coded in complementary strand; from 4762792 to 4761230)