Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 4680082
End position: 4680105
Length: 24

DNA sequence
>NC_002927, from 4680082 to 4680105 (24 bp); Bordetella bronchiseptica CCACCGCCATCGCCACCACCATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4679083-4680453	Sequence	BB4393 mpl UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase