Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 4564141
End position: 4564164
Length: 24

DNA sequence
>NC_002927, from 4564141 to 4564164 (24 bp); Bordetella bronchiseptica TCGACCTCGACCTCGATCTTGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4563901-4564806	Sequence	BB4286 nadC nicotinate-nucleotide pyrophosphorylase (Protein is coded in complementary strand; from 4564806 to 4563901)